NGS Dual UMI UDI Adapter Kit for Illumina,Set1 HYD361
NGS Dual UMI UDI Adapter Kit for Illumina® is a special kit for library construction on the Illumina high-throughput sequencing platform. It uses a dual-end adapter solution and includes the Illumina UMI Adapter (short adapter) used in the construction of the second-generation sequencing library and the specifically matched UDI Primer. After the adapter is connected, 8 bp of Unique Molecular Identifier (UMI) is added to both ends of the Insert DNA, which can be used to detect low-frequency mutations, effectively reduce label hopping and mismatches, and ensure the accuracy and authenticity of the analysis results. The kit is divided into 2 Sets, each of which contains 48 dual-end unique Index Primers. When used with the DNA Library Prep Kit for Illumina®, 96 dual-end unique Index-labeled libraries can be constructed. All reagents provided in the kit have undergo ne strict quality control and functional verification, which guarantees the stability and repeatability of library construction to the greatest extent.
Components
|
Cat.No. |
Components |
48×2 T |
48×4 T |
|
HYD361 |
UMI Adapter |
480 μL |
960 μL |
|
UDI Primer 001-048 |
10 μL each |
20 μL each |
|
|
HYD362 |
UMI Adapter |
480 μL |
960 μL |
|
UDI Primer 049-096 |
10 μL each |
20 μL each |
Storage
Store at -15℃~ -25℃ for 18 months.
Notes
1. The concentration of UMIAdapter in this kit is 15 μM. The amount of adapter used for a single library construction is adjusted according to the library construction kit used. The concentration of UDI Primer is 5 μM.
2. The PE Adapter provided in this kit is a universal short adapter, which requires PCR amplification to obtain a complete library. UDIPrimer provides Barcode sequence tags for distinguishing samples during high-throughput sequencing.
3. This kit has two specifications, each providing 48 UDI Primers, which can be used to construct up to 96 double-end unique index labeled libraries.
4. Do not heat the adaptors, let it dissolve slowly at room temperature, and the laboratory temperature is best set to 20-25 °C. It is recommended to store it in aliquots avoiding repeated freeze-thaw and store it at 4°C for a short time.
5. The DNA library structure using the NGS Dual UMI UDI Adapter Kit for Illuminais as follows:
6. For your safety and health, please wear a lab coat and wear disposable gloves.
7. This product is for scientific research purposes only!
Sequence information
1. UMIAdapter for Illumina
5´-/Phos/ NNNNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNN*T-3´
2. i5 Index Primer for Illumina
5´-AATGATACGGCGACCACCGAGATCTACAC [i5Index]ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3´
3. i7 Index Primer for Illumina
5´-CAAGCAGAAGACGGCATACGAGAT [i7 Index] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3´
[i5 Index] 8 bp i5 sequence，[i7 Index]8 bp i7 sequence
4. The Index name corresponding to each primer, the Index sequence contained in the primer, and the corresponding Index sequence information during sequencing are shown in the following table: