Leave Your Message

NGS RNA 384 CDI Primer for Illumina,Set 2 HYD334

NGS RNA 384 CDI Primer for Illumina are two special kits designed for RNA library preparation for Illumina platforms, each set contains the PE adapter, 8 kinds of i5 index primers and 12 kinds of i7 index primers.

Cat.No.: HYD334

Specification: 96x2T

    NGS RNA 384 CDI Primer for Illumina are two special kits designed for RNA library preparation for Illumina platforms, each set contains the PE adapter, 8 kinds of i5 index primers and 12 kinds of i7 index primers.Set1 and Set 2 can provide a total of 384 kinds of dual index combinations. All the reagents provided in the kit are subjected strict quality control and functional verification to ensure the maximum stability and repeatability of the library preparation.

    Components

    Cat.No.

    Components

    96×2 T

    HYD333

    PE Adapter

    320 μL

    RP501-508

    60 μL each

    RP701-712

    40 μL each

    HYD334

    PE Adapter

    320 μL

    RP509-516

    60 μL each

    RP713-724

    40 μL each

    Storage

    Store at -15℃~ -25℃ for 18 months.

    Notes

    1. The concentration of PE Adapter in this kit is 15 μM. The amount of adapter used for a single library construction is adjusted according to the library construction kit used. The concentration of Index Primer is 10μM.

    2. The PE Adapter provided in this kit is a universal short adapter, which requires PCR amplification to obtain a complete library. Index Primer provides Indexsequence tags for distinguishing samples during high-throughput sequencing.

    3. Each set of this kit contains 8 i5 Index Primers (RP 5xx) and 12 i7 Index Primers (RP 7xx), which can be combined to construct 96 different combinations of double-end Index-tagged libraries. 2 sets provide a total of 16 i5 Index Primers and 24 i7 Index Primers. You can use the i5IndexPrimer (or i7 Index Primer) in HYD333in combination with the i7 Index Primer (or i5 Index Primer) in HYD334 to construct up to 384 different combinations of paired-end index-tagged libraries.

    4. Do not heat the adaptors, let it dissolve slowly at room temperature, and the laboratory temperature is best set to 20-25 °C. It is recommended to store it in aliquots avoiding repeated freeze-thaw and store it at 4°C for a short time.

    5. The sequencing library structure constructed using the NGS RNA 384 CDI Primer for Illuminais as follows:

    6. For your safety and health, please wear a lab coat and wear disposable gloves.

    7. This product is for scientific research purposes only!

    Sequence information 

    1. PE Adapter for Illumina

    5´-/5Phos/ GATCGGAAGAGCACACGTCTGAACTCCAGT*C -3´ 5´-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´

    2. i5 Index Primer for Illumina

    5´-AATGATACGGCGACCACCGAGATCTACAC[i5 Index]ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3´

    3. i7 Index Primer for Illumina

    5´-CAAGCAGAAGACGGCATACGAGAT[i7 Index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3´

    [i5 Index] 8 bp i5 sequence,[i7 Index]8 bp i7 sequence

    4. The Index name corresponding to each primer, the Index sequence contained in the primer, and the corresponding Index sequence information during sequencing are shown in the following table:

    Leave Your Message