Hyasen Biotechnology Co., Ltd.
Leave Your Message
Products Categories
Best Sellers

NGS Truncated UDI Primer Kit for Illumina, Set4 (Plate,289-384) HYD324

NGS Truncated UDI Primer Kit for Illumina is a specialized adapter kit designed for library preparation of Illumina high-throughput sequencing platform. it includes PE Adapters and UDI Primers that are commonly used in next-generation sequencing library preparation.

Cat No.:HYD324

Specification:96X1T/96X2T

    NGS Stubby UDI Primer Kit for Illumina is a dedicated linker kit for library construction on the Illumina® high-throughput sequencing platform, including PE Adapter and UDI Primer used in next-generation sequencing library construction. The UDI Primer is a master mix of i5 and i7 Primer used with the DNA Library Prep Kit for Illumina®, and HYD321-324 are available in plate packs with 96 indexes each, allowing the construction of up to 384 double-ended unique Index-labeled libraries. All reagents provided in the kit undergo rigorous quality control and functional verification to maximize library construction stability and repeatability.

    Reagent Composition

    Cat.No. Components 96×1 T 96×2 T
    HYD321 PE Adapter 336 µL 672 µL
    UDI Primer 001-096 5 µL each 10 µL each
    HYD322 PE Adapter 336 µL 672 µL
    UDI Primer 097-192 5 µL each 10 µL each
    HYD323 PE Adapter 336 µL 672 µL
    UDI Primer 193-288 5 µL each 10 µL each
    HYD324 PE Adapter 336 µL 672 µL
    UDI Primer 289-384 5 µL each 10 µL each

    Storage Conditions

    All the components are shipped with dry ice and can be stored at -15℃~ -25℃ for 18 months.

    Specifications

    Product Line Illumina platform adapter
    Starting Material DNA
    Index type CDI
    Workflow Step Library Barcoding
    Library type Dual-indexed fragment libraries
    Notes
    1) The concentration of PE Adapter in this kit is 15 μM, and the amount of linker used for individual library construction is adjusted according to the kit used.

    2) The PE Adapter provided with this kit is a general-purpose short adapter that requires PCR amplification to obtain a complete library.

    3) UDI Primer provides Index sequence tags at a concentration of 12.5 μM for sample differentiation during high-throughput sequencing.

    4) Do not heat the adaptors, let it dissolve slowly at room temperature, and the laboratory temperature is best set to 20-25 °C. It is recommended to store it in aliquots avoiding repeated freeze-thaw and store it at 4°C for a short time.

    5) The DNA library structure using the NGS Stubby UDI Primer Kit for Illumina is as follows:

    图片7
    6) For your safety and health, please wear a lab coat and wear disposable gloves.

    7) This product is for scientific research purposes only!

    Sequence information

    PE Adapter for Illumina:
    5´-/5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGT*C-3´
    5´-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3´
    i5 Index Primer for Illumina:
    5´-AATGATACGGCGACCACCGAGATCTACAC[i5Index]ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3´ i7 Index Primer for Illumina:
    5´-CAAGCAGAAGACGGCATACGAGAT[i7Index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-3´
    [i5 Index] 8 bp i5 sequence,[i7 Index]8 bp i7 sequence
    The corresponding locations of each primer in 96-well plate are shown:

    9a966c3602f27255f8df46dbddcb1a0

    Leave Your Message