NGS Unique Dual Barcode Primer Kit for MGI,Set1 HYD325
NGS Unique Dual Barcode Primer Kit for MGI is a dedicated supporting kit for DNA library construction based on the MGI high-throughput sequencing platform. Using a two-end connector solution, it includes the UDB Adapter and UDB Primer which used in the second-generation sequencing library construction. There are four kinds of sets, and each contains 96 dual-end unique Barcode labeled UDB Primers used in the second generation sequencing library. Together with the MGI library kit provided by Hyasen, it can build up to 384 dual-end unique Barcode labeled libraries. All the reagents provided in the kit were subjected to strict quality control and functional validation, maximizing the stability and repeatability of the library construction.
Components
|
Cat.No. |
Components |
96×1 T |
96×2 T |
|
HYD325 |
UDB Adapter |
480 μL |
960 μL |
|
UDB Primer 001-096 |
5 μL each |
10 μL each |
|
|
HYD326 |
UDB Adapter |
480 μL |
960 μL |
|
UDB Primer 097-192 |
5 μL each |
10 μL each |
|
|
HYD327 |
UDB Adapter |
480 μL |
960 μL |
|
UDB Primer 193-288 |
5 μL each |
10 μL each |
|
|
HYD328 |
UDB Adapter |
480 μL |
960 μL |
|
UDB Primer 289-384 |
5 μL each |
10 μL each |
Storage
Store at -25~-15℃ for 18 months.
Notes
1. For your safety and health, please wear a lab coat and disposable gloves.
2. The concentration of UDB Adapter in this kit is 10 μM, and the amount of adapter used for the individual libraryconstruction is adjusted according to the library construction kit and the starting template input.
3. The UDB Adapter provided by this kit is a universal short adapter, and the complete library should be obtainedby PCR amplification. UDB Primer provide Barcode sequence tags to distinguish samples during high-throughput The concentration of UDB primer in this kit is 10 μM.
4. There are four kinds of Sets, each set contains 96 dual-end unique Barcode labeled UDB Primers, and fourSets can build 384 dual-end unique Barcode labeled libraries.
5. Do not heat the adapter, it should slowly dissolve at room temperature, the laboratory temperature is best set at20-25℃. The adapter should avoid repeated freezing and thawing. It is recommended to be stored separately, and can be briefly stored at 4℃.
6. The sequencing library structureby using the NGS Unique Dual Barcode Primer Kit for MGI. is as follows:
7. Double Barcode sequence designed for MGI platform is based on the principle of base balance. Every 8 as a group for Barcode 1-48 and Every 4 as a group for Barcode 49-384. In order to achieve the best sequencing quality, when building libraries with different sample numbers, it is recommended to use continuous barcode to construct libraries with more than 8 Barcodes, and then perform machine sequencing after mixing.
8. This product is for research use only.
Sequence information
1. UDB Adapter for MGI
5´-/5Phos/ AGTCGGAGGCCAAGCGGTCTTAGGAAGACAATCAG -3´
5´-TTGTCTTCCTAAGCAACTCCTTGGCTCACAGAACGACATGGCTACGATCCGACTT -3´
2. Barcode 2 Primer for MGI
5´-/5Phos/CTCTCAGTACGTCAGCAGTT[Barcode 2]CAACTCCTTGGCTCACAGAAC-3´
3. Barcode 1 Primer for MGI
5´-GCATGGCGACCTTATCAG[Barcode 1]TTGTCTTCCTAAGACCGCTTGG-3´
[Barcode 2] represents the 10 bp Barcode 2 sequence and [Barcode 1] represents the 10 bp Barcode 1 sequence.